B.O.B.B. B.O.B.B. B.O.B.B.
B.O.B.B.B.O.B.B.B.O.B.B.B.O.B.B. B.O.B.B.
  corner   



HOME

ARCHIVES



Sonarstrange

The Daily Dewayne

Empty

This page is powered by Blogger.

 

Wednesday, October 31, 2001

 
My vote would be for 7:50, with dinner at Wolfgang Puck beforehand. Any other takers?

 
Not to change the subject...but, can we change the subject slightly? I found a really interesting Flash thingy that explains how digital light processing/projector (DLP) works. This is based upon Texas Instruments' technology. Very cool!



Tuesday, October 30, 2001

 
Both the AMC Fashion Square 8 and Regal Winter Park Village 20 are without merit, and you won't find me in either complex. And yes, there's not a perfect cinema in the area, period. If I am forced into giving merit to one of the two horrible theaters that have taken center stage on this 'blog, then I'll give it to the AMC Fashion Square 8. At least they can use age and the demise of the Navy Training Center as an excuse. If nothing else, they have 12 less screens to torture people with.

 
yes, but dewayne, at least they're talking again.

 
i hate it when mom and dad fight. (p.s. spellcheck is back)

 
Unacceptable keystoning. Unmonitored sound volume/quality. It would surprise me if they have a projectionist at all during operating hours. Contrary to how I may be coming across, I do not wish your experience at this, or any other theater to be less than perfect. Perhaps your experience has been/will be less repulsive than my own. In any case, click here after the show. Maybe you'll be able to cancel out a few of the horrible things I have brought to their attention. For the record, I believe there are only two theaters in Orlando and vicinity that warrant visits... in order of show quality/experience, Loews Universal Cineplex and AMC Pleasure Island 24.

 
Uh-oh.

 
Those who know me well will know that I cannot remain silent when someone says anything nice about the Regal Winter Park Village 20. Although I'm sure the mention of it was in good spirit, and not to anger me, but it's got to be one of the worst theaters in Orlando, if not the world. If there were only two theaters in the state of Florida (the Regal Winter Park Village 20 and another in Key West) the "best theater near White Wolf" would be the latter. And just to bring this into the gutter where it belongs... I've seen/heard better projection/audio in adult video peep show booths than at the Regal Winter Park Village 20. Whew! Can you tell I hate that place?

On the other side of the coin... I'll be enjoying a winemaker dinner at Epcot that evening and won't be able to attend, even if you do go to Key West to see it. Do have an enjoyable time. I have good feelings about the film. Can't wait to see it.

 
Suggestion for Friday's BOBB Gathering: after dinner, see a movie. Any takers?



Monday, October 29, 2001

 
I forgot to mention before: Thanks to Helen for asking the as-yet-unasked question on my mind: How do all the BOBBers know each other? So, Boyd, when you do come up for air from all that writing, do share: how is it you know these folks? Or put another way, who roped you into the whole mess?

 
I know. I'm terribly out of the loop! Having to complete a section of "the book" every two weeks and producing 10 pages of screenplay each week is taking it's toll. Keep the faith until early December. I'll be getting my life back then!

Happy Halloween all!

 
I'm not even going there. I apparently made Boyd cry when I tried to do blogging statistics.

Boyd, wherefore art thou? I promise I'll recognize you next time.

 
Thanks, J.B., for hosting a fun evening! (I do agree, I can't get the music out of my head. It's been a Ricky Martin weekend on my internal sound system. Not that that's necessarily a bad thing.)



Saturday, October 27, 2001

 
ok, i admit i've not been a good BOBB blogger of late. my overall motivation level has been low; i think even (gasp!) thedailydewayne has suffered. It's been at least a lustrum since i've been this lethargic. so here i sit, waiting for Mr. No-Callback-Skills to call back, looking forward to making decisions about my medical coverage for next year (papers must be in Chicago by next Friday).

but since there was no nudity at JB's last night -- just nuddity and maraca mania -- i offer up this link to everyone to entertain themselves. (FYI: My title was "The Last Majorette.") Discuss.



Thursday, October 25, 2001

 
TTGAGCGCTGTCGTAACATCGATGAACACAGCAGTGACAACAGGTATGTTGGATACCGATACC
ATGTTGGTTAAGGATATGACCGGTATAATGTTGAGCGCTACCGGCACAGGTAGCACATAGTAG
TAGATGTTGAACGAGACAATGTTGAGCGCTACCGGCACAGGTAGCACATAG



Tuesday, October 23, 2001

 
Sounds like a great idea, J.B.! And so much closer to work for me. :)



Monday, October 22, 2001

 
Hmmm... okay, that could work, too... maybe the aftereffects of said drinks has caused the waning of posts, then?

 
I have new insight into this group. As soon as the topic veers from nudity, interest in posting wanes.

Is it too early to think about Friday @ 6?

 
This is a test post using AOL IM and BloggerBot!



Saturday, October 20, 2001

 
Hey, ya'll: Bj confirms that we have reservations for 7:15PM tonight for Boma at Animal Kingdom Lodge. This was the earliest seating that we could get. However, the meeting time is remaining 6PM to try to get a table earlier--since we all know how "priority seating" works at Disney.

Remember, everyone's invited! If you are attending, click here to send me a text message...we'll update the reservation to account for everyone!

 
Daniel, I think you got them right. But please note I did NOT make arrangements. Maybe it was the drinks at Cactus last night.... So count me in (Dan works 'till 11), but someone else make the call, and page me if it changes from 6p.

I'll have to check with The Other Half for Sunday, but note that many of the F&W tents do not open until 2p this year. (This from a reliable in-Park source.)



Friday, October 19, 2001

 
I'm a little confused on all these weekend plans. Is this a fair estimation?

Saturday - 6PM Boma at Animal Kingdom Lodge
Sunday - Epcot Food & Wine 10-11AM

You will be happy to know that Nancy Neon is back on the road! So, if you can't locate me, I'm most likely in the car. Driving....and driving...and driving... It's such a rush to be able to go somewhere at a moment's notice (sad isn't it...)! Now, if Time Warner can repair my cable modem Saturday morning, things will be back to normal.

 
Unfortunately, my weekend is booked... celebrating my 37th (I think) birthday, and 10 years with James (give or take a day). I look forward to a gathering next Friday though, wherever it might end up occuring.

 
Well, a day late I manage to respond. And I find I'm the first? What's happened? All that enthusiam, all that energy, burned out in a single burst of glorious posting. (sigh)
I'm all for a F&WFest trip... propose we meet in the Team Disney visitor parking lot to caravan over & coordinate Park admissions? 6ish?



Thursday, October 18, 2001

 
Well, I guess it could depend on how much you read into it, and where you put the emphasis.
At the risk of misaligning stars or something, who's up (wink, wink) for dinner on Saturday, once the Magic is back in port (snicker, giggle)?

 
I am flexi on dinner dates ... yet I can't promise that I can attend on Saturday. I will be entertaining a guest -- my college roommate -- and he would be a fine dinner companion, but I have to consultant with him. (He does enjoy White Wolf and Bangles singalongs.) Whatever.

Meanwhile, did anyone else notice that Eric didn't include nudity in his last post?

And does anyone think J.B.'s cheerleaders walked around in the nudd?

 
At the risk of misaligning stars or something, who's up for dinner on (gasp) Saturday, once the Magic is back in port?

 
I spent some naked time in the Vista Spa yesterday. Very nice. Today, however, I just feel like napping. Hey Bj, where's dinner this week? Oh, yes, on the Disney Magic. Wish you were all here.

 
Nudity! (I just wanted to ensure that it appeared on BOBB again today.) Thank you for your attention.



Wednesday, October 17, 2001

 
So today I was asked if "blush and bashful" was code for nudity. Hmmmm. Is it? It think of it as more of a cafe au lait.

 
I'm told that that kind of entertainment can result in families. Maybe that's the scheme.

 
I kept my clothes on in St. Maarten... although I am completely naked as I write this entry. Oops, gotta go. I see the security guy coming down the hall... and he's hot!



Tuesday, October 16, 2001

 
"Shocking, nauseating, hilarious..." -Entertainment Weekly
This is the quote from the box of my latest DVD 2-pack purchase: "Pink Flamingos" & "Female Trouble". Although it's also a fair description of our blog topics for the past 24 hours. With this kind of entertainment you can have a slushy drink and get naked! No one will even notice!

 
J.B. I knew you would cherish the word choice.

 
I meant to add my two cents to the conversation last night, but I promptly passed out upon seeing Dewayne's use of the word lustrum. (Stellar, really. I mean it!)

I didn't regain consciousness until this morning. I found myself on the floor near my desk. For some inexplicable reason, I was naked with a slushy drink at my side.



Monday, October 15, 2001

 
Consider myself alerted... I'm so glad I chose tonight to edit my own blog, so I could stumble on this auspicious moment. Who knew it would take putting two BOBB'ers on a big boat to flood the BOBB? (See, put eBri in a closed space with Ms. Blog-Or-Die, and one sees results!)
I'm all for slushy drinks; Does the BOBB collectively know each other well enough for communal nudity yet? Just asking.

 
Someone alert Eric, the BOBB statistician. Could this be the busiest blog day in BOBB history? It's been at least a lustrum since the site has seen this much activity. ;) Anyway, I can't decided whether to have a slushy drink or to get naked. Or both!

 
I must agree with Bj... a crappy day at sea on the Disney Magic is still better than a good day in Orlando. Of course, I have had to make adjustments to my lifestyle while on board... I found out, the hard way, that you must wear clothes while sitting in the Internet Café, even if there are no other guests present. All this chatter about slushy drinks has made me thirsty. Off to the bartender for another dose of something good for me.

 
Bj, on my last cruise (roughly 386 days ago, but who's counting?), my favorite bartender == the nearest one. My favorite spot to read whilst it was raining == 10 Forward elevator lobby. Only discovered due to the inherent Star Trek reference.

 
Since I'm generally having a really bad month, it's hard for me not be jealous of those of you that are afloat. But, I digress... I hope you all are having a blast! Have a very large fruity drink for me! Consider reserving a hammock for me at Castaway Cay...I might just show up if things get any worse...

 
Boyd, all that would accomplish is providing new fodder for eBri auctioning....
Wishing I was cruisin', too...

 
Oh, Bj and Brian, I wish we were there too!

 
Perhaps some early Christmas decorating at bJ's and blech's is in order. I saw some darling animated deer in the Big Lots sales circular!

 
Perhaps Dewayne forgeteth that as quickly as the coup could take place, The Daily Dewayne could become a straight porn site. (blech). And for J.B., who would no doubt ask me to "do that again..." (blech). Miss you all (not really, but it sounds good). I do wish you all were here however.



Sunday, October 14, 2001

 
now that B&B are out to sea, how about a bloodless coup of the BOBB by us landlubbers? we could have a reign of terror, perhaps by spelling her name bJ or buying all the Target ice-cream makers, thus crumbling the E-Bri empire. who's with me? (wink)



Friday, October 12, 2001

 
I had every intention of watching W&G last night, myself. But after the day I had yesterday I decided to visit my favorite bartender, despite the extended closure of my favorite watering hole. (NOTE: This page lies as of this morning; it says Mannequins was to reopen 10/10/01; word on the street now is early December at best. Dawn suffers through the poorly-chosen music videos at Motion in the interim.)

 
I feel SO out of touch. I had class last night and was unable to watch Thursday night television. (This would include Friends, Will & Grace, and Survivor.) I forgot to set the VCR, which wouldn't have helped anyway because the president threw off the whole evening's schedule. (Not saying it is a bad thing.)

I'm sending my apologies in advance for not making it to BOBB dinner this evening. I have a mandatory mid-term review tonight at school. Have fun all. J.B., I hope you get lucky and your favorite chanteuse throws a little love your way!



Thursday, October 11, 2001

 
Brian: It was my sorry attempt at cynically parallelling Bj's 10/10 9:34am entry.

 
Who's going to be hungry in about 26.5 hours?

 
Eric: I thought I was the one that left cryptic messages. I've read October 10th, 3:28p entry again and again, and must admit, I'm lost. Speaking of losing, and being cryptic, it's Survivor time again. Rather than pissing everyone (read Boyd) off and posting my predictions, I'll give you the option of decoding who I think ousted will be each Thursday. I'll do this with a simple strand of Web DNA:

TTGGTAACCGAGATGAGAGTCGTCATAAACGAGACAATGGCAGTCATGTTGATAAAGACCGGTACATAG

You may visit the DNA-o-gram Generator to decode my pick, or make one of your own. Also, as a side Survivor note, Brandon listed "smoking" as one of his hobbies on the official CBS site.

 
I thought you were doing a pretty good job of keeping that conversation running on your own... ;)



Wednesday, October 10, 2001

 
Would anyone like to sleep in on Saturday, October 13 wherever you happen to crash the night before until at least 11 am ?

 
I'm not sure how ALL the details of Brian's new restaurant would play out, but I think White Monkey Cafe has a certain ring. Oh, and the background music should consist of cheesy adult movie soundtracks from the 70s!

 
Note to Bj: No.

Brian, I read that with just-got-up-this-morning eyes, and the part about undertones & looseness took a couple of readings.

This morning, I'm off to get edumacated about "Business Acumen." Whee.

 
Hmmm... you've got me all thinking now. What would Brian MD's White Wolf Café be like? And who would work there (ya might want to hesitate before clicking on that one at work... if you work)? In any case, I'm actually quite happy with the current staff. I don't think there's a single cast member there that has rejected my brand of humor, or sexual undertone (I use that loosely). But as Dewayne will tell you, I've got other plans when it comes to bar/restaurant ownership. Pub Licks, Albert's Sons, or Good Things (not to mention Plaza Heat) are permanent fixtures in my "If I win the Lotto, I'd..." scheme. Stay tuned... I just have to sell a few more Fossil Bowl-O-Rama Wall Clocks to be able to pull this off.



Tuesday, October 09, 2001

 
If E-Bri bought the white wolf, i feel confident that the staff would include Live Monkeys.

Note to BJ: Do i know wilbur and bob? they aren't J.B.'s discoesque seamstress friend(s), are they?

 
Oh, my... well, at least it would be virtually guaranteed coverage at Who Would Buy That?.



Monday, October 08, 2001

 
i'm a little worried about the direction this site is taking: members are fighting over some folksy singing chick! -- especially in light of there being at least two members of the WWC wait staff that deserve our undivided attention. Wait a minute, never mind: y'all fight over Miss Egyptian, and I'll linger with the "leftovers." Besides, by the end of the week, Ebay Brian will have made enough profit to BUY the white wolf.

 
Ha. I found a post office that's open today. I am the eBay king. And thank you Bj, for sparking the lovely idea for another fruitless Brian MD site... I shall call it InfraredHackCodes.com (or maybe IRhacks.com). There, I can publish the Palm files containing the codes to illuminate Magical Moments buttons, trigger the animation on Buzz Lightyear's Space Ranger Spin (or whatever it's called), and change the channels on the TVs at Smokey Bones. Soon, the world will be mine!



Saturday, October 06, 2001

 
Conspiracy Theory: Daniel and Boyd are one in the same person. I mean, have any of you seen the two of them together? Daniel's sick and Boyd appears. Boyd has other obligations and Daniel appears. Hmmmm....

Oh and, J.B., the Walk Like an Egyptian Chick is mine!

 
Thanks to Brian, I am an even leaner, meaner blogging machiner. I should be able to boost my monthly average now, Eric.
Enjoyed WWC again. Am I right in believing that Bj is bringing a beautiful stranger next week?



Friday, October 05, 2001

 
J.B., everyone has a crush on you. Oops, wait a minute. I mean, everyone wants to crush you. Well, 'cept me of course, 'cuz I like triple-cheese sandwiches and fat-laden soups. I'm home from the dentist. I don't think I have another dental appointment for several weeks. What will I do? Oh, I know... I'll learn everything there is to know about MIDI. But first, a nap.

 
If they are, Bj, you need to order two helpings this week. Either that, or you need to NOT have any tonight so you are sufficiently weaned of this addiction before B2B....

 
I shall attend tonight's White Wolf gathering. Maybe there's something new on the menu. (insert Frenchy laugh here: Haahn, Haaahn, Hooohn!)



Thursday, October 04, 2001

 
Ugh! My Wan names leave much to be desired.

When using my name, the result is Loose-Lipped Controller.

When using mere mortal, the result is Childish Gambino.

What is to become of me?

 
Oh, no. Far be it from me to imply it was all about the numbers. That is too much like my work, where my projects are rated by participants, and if it doesn't hit the magical "satisfaction" number of 4.17 (of 5), I am doomed to do it again, and again, until it DOES.
I should have included a "for entertainment purposes only" disclaimer.
Speaking of entertainment, have we finalized tomorrow's dining plans?

 
In my grief I forgot. Great Googly Moogly! Welcome J.B.

 
I'm trying to focus on my monitor through my tears. My blog numbers look pitiful! I must try harder . . .*sob*

I told myself I wouldn't cry

 
Is it all about the numbers Eric? Of course I'm only asking that so I can bump up my BOBB level. Well, it's nap time. Nighty, night.

 
Happy Birthday, BOBB!

Just noticed that today is BOBB Blog's 1-month birthday. BJ made the first post a month ago today.
So, whilst eating lunch, I figured out how many posts-per-day each BOBBer has been averaging since their first post.

sonarstrange: 1.25
Bj on BOBB: 1.00

instantmashedpotatoes: 0.72
Brian on BOBB: 0.40

thedailydewayne: 0.81
Dewayne on BOBB: 0.40

empty: 0.55
Daniel on BOBB: 0.10

midafternoonsnack: 0.81
Eric on BOBB: 0.70

meremortal: 0.17
Boyd on BOBB: 0.23

J.B. on BOBB: 1.00

 
Cats and dogs living together! J.B. has posted. What next, an actual Boyd sighting?

I am so hungry right now. I'm ready to talk food. I like the Cooker idea (y'all) and the P.F. Chang notion. But, as always, I'm flexi.

Tomorrow is Day 3 of the Roadrunner Hostage Crisis. I'll be ready to eat/drink/be merry. (How about Dairy Queen?)

 
Oh, my, God, Buffy, J.B. has posted. It is surely the sign of the Apocalypse. Oddly enough though, he does make a good point. Where the hell is dinner on Friday?

 
What a quandry. If I say now that Bj's blog were amusing enough, I get branded "easily amused." If I don't, I come across as mean. (sigh)
Of course, I also risk being branded "easily pleased" (or worse yet, just "easy") by saying any of the proposed dining establishments would be fine with me....

 
Welcome, J.B. Bj, any food-related thoughts? (Or thoughts that don't involve SCORM or counting shopping days?)



Wednesday, October 03, 2001

 
The latest in the name game thread: Get your Wu-Tang Gang name here.

If you put in my name, you'll see how inaccurate it is: I'm clearly more of an ass than a mule.

Your thoughts?

 
The Day Without a Blog?
Apparently lack of inspiration is spreading. It's the rare day that Bj doesn't blog at least something before lunch. Fortunately, Dewayne saved the day just mere moments ago with the only new blog for 10/03/01. Thanks, Dewayne!

Update at 3:09:
Go figure, Bj actually did blog on her site before 2 pm, but it didn't show until just now. But it still was after lunch. :)



Tuesday, October 02, 2001

 
A weary voice was heard to say "Good Morning." Was it a real voice? Could it have been imagined by the BOBB collective? Their powers are very great. Perhaps they willed the voice into being.

To the untrained eye it may seem that I fell off the planet...oh, wait, I think I may have. Sorry to be out of the "blog" for so long. Expect new posts to mere mortal soon! Hope you're all well.

 
I made it back, safe and sound from my latest dental adventure (another tooth lighter as of Monday afternoon).





This page is powered by Blogger.